Skip to Content
Merck
All Photos(1)

Key Documents

EMU021801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcr4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGCCCACCATCTACTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACCAACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTGGGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTTGCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Dong-Hua Luo et al.
Journal of translational medicine, 11, 203-203 (2013-08-31)
Recent studies have indicated that the expression of endothelin A receptor (ETAR) and chemokine receptor 4 (CXCR4) could be used as an indicator of the metastatic potential of nasopharyngeal carcinoma (NPC). The aim of this study was to determine the
Yan Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 21(11), 1310-1317 (2014-08-31)
C-X-C chemokine receptor type 4 (CXCR4) signaling has been demonstrated to be involved in cancer invasion and migration; therefore, CXCR4 antagonist can serve as an anti-cancer drug by preventing tumor metastasis. This study aimed to identify the CXCR4 antagonists that
Shijie Ma et al.
International journal of clinical oncology, 20(3), 525-530 (2014-08-26)
CXCR4 and glycogen synthase kinase-3β (GSK3β) promote proliferation and invasion of pancreatic cancer. Inhibition of CXCR4 suppresses GSK3β expression. However, the molecular mechanism by which CXCR4 contributes to human pancreatic cancer metastasis is not completely understood. In this study, therefore
Yingzhuan Zhan et al.
Journal of cellular and molecular medicine, 19(7), 1614-1623 (2015-03-11)
The increased migration and invasion of breast carcinoma cells are key events in the development of metastasis to the lymph nodes and distant organs. CXCR4, the receptor for stromal-derived factor-1, is reportedly involved in breast carcinogenesis and invasion. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service