Skip to Content
Merck
All Photos(1)

Key Documents

EHU133701

Sigma-Aldrich

MISSION® esiRNA

targeting human TYMS

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CZK 6,310.00
50 μG
CZK 11,300.00

CZK 6,310.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
CZK 6,310.00
50 μG
CZK 11,300.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CZK 6,310.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCAAAGGAGCTCGAAGGATATTGTCAGTCTTTAGGGGTTGGGCTGGATGCCGAGGTAAAAGTTCTTTTTGCTCTAAAAGAAAAAGGAACTAGGTCAAAAATCTGTCCGTGACCTATCAGTTATTAATTTTTAAGGATGTTGCCACTGGCAAATGTAACTGTGCCAGTTCTTTCCATAATAAAAGGCTTTGAGTTAACTCACTGAGGGTATCTGACAATGCTGAGGTTATGAACAAAGTGAGGAGAATGAAATGTATGTGCTCTTAGCAAAAACATGTATGTGCATTTCAATCCCACGTACTTATAAAGAAGGTTGGTGAATTTCACAAGCTATTTTTGGAATATTTTTAGAATATTTTAAGAATTTCACAAGCTATTCCCTCAAATCTGAGGGAGCTGAGTAACACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Motoki Watanabe et al.
Cancers, 13(5) (2021-03-04)
Natural products have numerous bioactivities and are expected to be a resource for potent drugs. However, their direct targets in cells often remain unclear. We found that rabdosianone I, which is a bitter diterpene from an oriental herb for longevity
Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service