Skip to Content
Merck
All Photos(1)

Key Documents

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yun Peng Shao et al.
Neurourology and urodynamics, 37(8), 2470-2479 (2018-06-20)
The present work evaluated preventive effect of curcumin on cisplatin-induced bladder cystopathy. Fifteen female rats were divided into (i) Control group administered with physiological saline solution for 5 days; (ii) Cis-P group injected with cisplatin (6 mg/kg); and (iii) Cis-Cur group
Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Lu Gao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(10), 3322-3338 (2018-07-22)
Diabetes contributes to cardiovascular complications and the pathogenesis of cardiac remodeling that can lead to heart failure. We aimed to evaluate the functional role of LAZ3 in diabetic cardiomyopathy (DCM). Streptozotocin (STZ) was used to induce a diabetic mouse model.
Valia T Mihaylova et al.
Cell reports, 24(11), 3000-3007 (2018-09-13)
Rhinovirus is a leading cause of acute respiratory infections and asthma attacks, but infections are also frequently cleared from the nasal mucosa without causing symptoms. We sought to better understand host defense against rhinovirus by investigating antiviral defense in primary
Jeong Il Yu et al.
Scientific reports, 7(1), 14986-14986 (2017-11-10)
Although efficacy of combined histone deacetylase (HDAC) inhibitors and conventional photon radiotherapy is being tested in clinical trials, their combined effect with proton beam radiotherapy has yet to be determined. Here, we compared combined effect of valproic acid (VPA), a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service