Skip to Content
Merck
All Photos(1)

Documents

EHU055731

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGA5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTCTCAACTTCTCCTTGGACCCCCAAGCCCCAGTGGACAGCCACGGCCTCAGGCCAGCCCTACATTATCAGAGCAAGAGCCGGATAGAGGACAAGGCTCAGATCTTGCTGGACTGTGGAGAAGACAACATCTGTGTGCCTGACCTGCAGCTGGAAGTGTTTGGGGAGCAGAACCATGTGTACCTGGGTGACAAGAATGCCCTGAACCTCACTTTCCATGCCCAGAATGTGGGTGAGGGTGGCGCCTATGAGGCTGAGCTTCGGGTCACCGCCCCTCCAGAGGCTGAGTACTCAGGACTCGTCAGACACCCAGGGAACTTCTCCAGCCTGAGCTGTGACTACTTTGCCGTGAACCAGAGCCGCCTGCTGGTGTGTGACCTGGGCAACCCCATGAAGGCAGGAGCCAGTCTGTGGGGTGGCCTTCGGTTTACAGTCCCTCATCTCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oded Komemi et al.
International journal of cancer, 144(7), 1633-1644 (2018-09-09)
The extracellular matrix (ECM) affects cancer cell characteristics. Inability of normal epithelial cells to attach to the ECM induces apoptosis (anoikis). Cancer cells are often anoikis resistant, a prerequisite for their metastatic spread. Previously we demonstrated that the placenta manipulates
Hao Liu et al.
Therapeutic advances in chronic disease, 11, 2040622320912661-2040622320912661 (2020-04-29)
D-mannose exhibits strong anti-inflammatory properties, but whether it has beneficial effects on preventing and treating osteoporosis remains unknown. Female, 12-month-old senile C57BL6/J mice (s-Man group) and 8-week-old ovariectomized C57BL6/J mice (OVX-Man group) were treated with D-mannose in drinking water for
Carola Parolin et al.
Frontiers in microbiology, 9, 2630-2630 (2018-11-22)
Lactobacilli play a crucial role in maintaining the ecological equilibrium of the vaginal niche, preventing the colonization of exogenous microorganisms. Although many studies have discussed the mechanisms displayed by lactobacilli in counteracting several urogenital pathogens, a few data are available

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service