Skip to Content
Merck
All Photos(1)

Key Documents

EHU007981

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX12

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCCTGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATGGTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTAAACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAACTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGAGCCCTAGAGTGACTCTACCTGCAAGATTTCACATCAGCTTTAGGACTGACATTTCTATCTTGAATTTCATGCTTTCCTAAAGTCTCTGCTGCTAAGGCTCTATTTCCTCCCCCAGTTAAACCCCCTACATTAGTATCCCACTAGCCCAGGGGAGCAGTAAACTTTCTCTGCAAAGACTAGATCCTTTTTTACGCTTTGCAGACCGCATAGTCACTGTCTCAACTACTCAGCTCTCCTGCTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

William H Witola et al.
Infection and immunity, 82(7), 2670-2679 (2014-04-02)
ALOX12 is a gene encoding arachidonate 12-lipoxygenase (12-LOX), a member of a nonheme lipoxygenase family of dioxygenases. ALOX12 catalyzes the addition of oxygen to arachidonic acid, producing 12-hydroperoxyeicosatetraenoic acid (12-HPETE), which can be reduced to the eicosanoid 12-HETE (12-hydroxyeicosatetraenoic acid).
Ji-Li Li et al.
Biochemical and biophysical research communications, 516(3), 991-998 (2019-07-07)
Spinal cord injury (SCI) is terrible damage leading to the deficiencies and results in infinite inconvenience to sufferers. The effective treatment for SCI still meets a larger number of problems. Herein, the underlying molecular mechanism and novel therapy of SCI
Zhen Huang et al.
Biochemical and biophysical research communications, 514(1), 24-30 (2019-04-25)
Arachidonate lipoxygenase12 (Alox12) and its metabolites 12S-hydroxyeicosatetraenoic acid (12S-HETE) have been implicated in influencing tumor transformation and progression. In this study, we have systematically evaluated the expression, function and the downstream effectors of Alox12 in breast cancer using loss- and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service