Skip to Content
Merck
All Photos(1)

Key Documents

EHU001661

Sigma-Aldrich

MISSION® esiRNA

targeting human CNOT2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGGAAGAGCTCCTTATGTTGGAATGGTAACAAAACCAGCAAATGAACAATCCCAGGACTTCTCAATACACAATGAAGATTTTCCAGCATTACCAGGCTCCAGCTATAAAGATCCAACATCAAGTAATGATGACAGTAAATCTAATTTGAATACATCTGGCAAGACAACTTCAAGTACAGATGGACCCAAATTCCCTGGAGATAAAAGTTCAACAACACAAAATAATAACCAGCAGAAAAAAGGGATCCAGGTGTTACCTGATGGTCGGGTTACTAACATTCCTCAAGGGATGGTGACGGACCAATTTGGAATGATTGGCCTGTTAACATTTATCAGGGCAGCAGAGACAGACCCAGGAATGGTACATCTTGCATTAGGAAGTGACTTAACAACATTAGGCCTCAATCTGAACTCTCCTGAAAATCTCTACCCCAAATTTGCGTCACCCTGGGCATCTTCACCTTGTCGACCTCAAGACATAGACTTCCATGTTCCATCTGAGTACTTAACGAACATTCACATTAGGGATAAGCTGGCTGCAATAAAACTTGGCCGATATGGTGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eun-Ok Kim et al.
International journal of molecular medicine, 45(2), 324-332 (2020-01-03)
TRAIL is an attractive candidate for anticancer therapy in a variety of tumors since it targets only tumors and not normal tissue. However, a remaining major hurdle is that the majority of tumors exhibit a resistance mechanism against the effects
Eun Jung Sohn et al.
Cancer letters, 412, 88-98 (2017-10-13)
Here the underlying role of CNOT2, a subunit of CCR4-NOT complex, was elucidated in cancer progression. CNOT2 was overexpressed in HIT-T15, ASPC-1, BXPC-3, PC-3, LNCaP, MCF-7 and MDA-MB-231 cell lines, which was confirmed by Tissue array in various human tumor
Ji Hoon Jung et al.
Cells, 9(4) (2020-04-23)
Though midline1 interacting protein 1 (MID1IP1) was known as one of the glucose-responsive genes regulated by carbohydrate response element binding protein (ChREBP), the underlying mechanisms for its oncogenic role were never explored. Thus, in the present study, the underlying molecular
Kwon Jeong et al.
Oncotarget, 8(28), 46034-46046 (2017-05-26)
Though CNOT2 is involved in regulation of adipogenic differentiation, apoptotic cell death and metastasis, the underlying autophagic mechanism of CNOT2 was unknown until now. Thus, in the present study, the critical role of CNOT2 in autophagy was elucidated in association

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service