Skip to Content
Merck
All Photos(1)

Key Documents

EMU067571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Creb1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGGTGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCCAACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCTGGAGTTGTTA

Ensembl | mouse accession no.

ENSMUSG00000025958

NCBI accession no.

NM_001037726

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CREB1(12912) , Creb1(12912)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mutsumi Fujii et al.
Experimental neurology, 261, 396-403 (2014-07-25)
Early brain injury (EBI) which comprises of vasogenic edema and apoptotic cell death is an important component of subarachnoid hemorrhage (SAH) pathophysiology. This study evaluated whether cannabinoid receptor type 2 (CB2R) agonist, JWH133, attenuates EBI after SAH and whether CB2R
Jian Ye et al.
EMBO molecular medicine, 6(10), 1294-1311 (2014-09-19)
Accumulating evidence suggests the immunosuppressive microenvironments created by malignant tumors represent a major obstacle for effective anti-tumor immunity. A better understanding of the suppressive mechanisms mediated by tumor microenvironments and the development of strategies to reverse the immune suppression are
Wencheng Li et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(2), R138-R147 (2015-05-23)
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet
Kaiyan Hui et al.
Cancer letters, 354(1), 189-199 (2014-08-17)
Supranutritional selenite has anti-cancer therapeutic effects in vivo; however, the detailed mechanisms underlying these effects are not clearly understood. Further studies would broaden our understanding of the anti-cancer effects of this compound and provide a theoretical basis for its clinical
Xiuying Ma et al.
Oncology reports, 35(1), 189-196 (2015-11-05)
In the periphery of pancreatic ductal adenocarcinoma (PDAC), high accumulation of tumor-associated macrophages (TAMs), which exhibit M2 phenotype, has been shown to be correlated with extra-pancreatic invasion, lymph vessel invasion, lymph node involvement and shortened survival time. However, mechanisms by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service