Skip to Content
Merck
All Photos(1)

Key Documents

EHU151811

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3R1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGGCAAGGTTATATGCACTTTCTCATGATTTACAGAGAAGTGAATAACTGCAAAGTGAAGTTGCTTCTTCTACTTCAGTCTTCTCTCACTTTGATTTGCTAGTTGTTATCAATTAATGACAATTACAAACCTACTGTATCTCTAATACAGTGTGACTGGTCAGGTATTTCAGTTCTTAGGAAGGAAGTGCCAAGTTTGTTTTTGGGTTCCTGGAACAGCGCTCACCTTTGTTTAGAACACTGGTTTAAAGGGATAATCATCTCTGTCACATTAGACTATCCATCATGACCAGCAAATACTCATTTTAGGAAAAAAAAAAGCATGATCTGAAAAATACTTTTGGTGGTATGTTGGTTACCCTCCTAGCTTTCCATTTGGTTTAGAACATAAAGCAAATAGACACAGTCATACTGTCACTGCTCTGGACTGTGTGGAGCTCGCTAAAGTCA

Ensembl | human accession no.

ENSG00000145675

NCBI accession no.

NM_181504

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PIK3R1(5295) , PIK3R1(5295)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xinran Li et al.
Nature communications, 10(1), 716-716 (2019-02-14)
Copy number loss of PIK3R1 (p85α) most commonly occurs in ovarian cancer among all cancer types. Here we report that ovarian cancer cells manifest a spectrum of tumorigenic phenotypes upon knockdown of PIK3R1. PIK3R1 loss activates AKT and p110-independent JAK2/STAT3
Reem Ali et al.
Cells, 8(10) (2019-10-23)
Ataxia-telegiectasia mutated (ATM), phosphatase and tensin homolog (PTEN), and p85α are key tumour suppressors. Whether ATM regulates PTEN expression and influence platinum sensitivity is unknown. We generated ATM knockdowns (KD) and CRISPR knock outs (KO) in glioblastoma (LN18, LN229) and
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Xue Bai et al.
Oncology reports, 33(6), 3085-3092 (2015-05-13)
Cervical cancer is the second most common women carcinoma worldwide and the fourth leading cause of cancer-associated mortality in women. Butein, a bioactive flavonoid isolated from numerous native plants, has been shown to induce apoptosis and inhibits migration and invasion
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service