Skip to Content
Merck
All Photos(1)

Key Documents

EHU070911

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAR

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACGGGACAAATCCTAGAGGGTATAAAATCATCTCTGCTCAGATAATCATGACTTAGCAAGAATAAGGGCAAAAAATCCTGTTGGCTTAACGTCACTGTTCCACCCGGTGTAATATCTCTCATGACAGTGACACCAAGGGAAGTTGACTAAGTCACATGTAAATTAGGAGTGTTTTAAAGAATGCCATAGATGTTGATTCTTAACTGCTACAGATAACCTGTAATTGAGCAGATTTAAAATTCAGGCATACTTTTCCATTTATCCAAGTGCTTTCATTTTTCCAGATGGCTTCAGAAGTAGGCTCGTGGGCAGGGCGCAGACCTGATCTTTATAGGGTTGACATAGAAAGCAGTAGTTGTGGGTGAAAGGGCAGGTTGTCTTCAAACTCTGTGAGGTAGAATCCTTTGTCTATACCTCCATGAACATTGACTCGTGTGTTCAGAGCCTTTG

Ensembl | human accession no.

ENSG00000160710

NCBI accession no.

NM_001025107

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAR(103) , ADAR(103)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eduardo A Sagredo et al.
Biochimica et biophysica acta. Molecular cell research, 1867(8), 118716-118716 (2020-04-11)
RNA editing has emerged as a novel mechanism in cancer progression. The double stranded RNA-specific adenosine deaminase (ADAR) modifies the expression of an important proportion of genes involved in cell cycle control, DNA damage response (DDR) and transcriptional processing, suggesting
Mako Yanai et al.
Journal of virology, 94(6) (2019-12-20)
Cells sense pathogen-derived double-stranded RNA (dsRNA) as nonself. To avoid autoimmune activation by self dsRNA, cells utilize A-to-I editing by adenosine deaminase acting on RNA 1 (ADAR1) to disrupt dsRNA structures. Considering that viruses have evolved to exploit host machinery
Maria Pujantell et al.
Scientific reports, 9(1), 19848-19848 (2019-12-29)
Infection by human papillomavirus (HPV) alters the microenvironment of keratinocytes as a mechanism to evade the immune system. A-to-I editing by ADAR1 has been reported to regulate innate immunity in response to viral infections. Here, we evaluated the role of
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service