Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU081381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lrp5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCACGGGTGTCAAAGAGGCCTCTGCACTGGACTTTGATGTGTCCAACAATCACATCTACTGGACTGATGTTAGCCTCAAGACGATCAGCCGAGCCTTCATGAATGGGAGCTCAGTGGAGCACGTGATTGAGTTTGGCCTCGACTACCCTGAAGGAATGGCTGTGGACTGGATGGGCAAGAACCTCTATTGGGCGGACACAGGGACCAACAGGATTGAGGTGGCCCGGCTGGATGGGCAGTTCCGGCAGGTGCTTGTGTGGAGAGACCTTGACAACCCCAGGTCTCTGGCTCTGGATCCTACTAAAGGCTACATCTACTGGACTGAGTGGGGTGGCAAGCCAAGGATTGTGCGGGCCTTCATGGATGGGACCAATTGTATGACACTGGTAGACAAGGTGGGCCGGGCCAACGACCTCACCATTGATTATGCCGACCAGCGACTGTACTGGACTGACCTGGACACCAACATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nellie Y Loh et al.
Cell metabolism, 21(2), 262-273 (2015-02-05)
Common variants in WNT pathway genes have been associated with bone mass and fat distribution, the latter predicting diabetes and cardiovascular disease risk. Rare mutations in the WNT co-receptors LRP5 and LRP6 are similarly associated with bone and cardiometabolic disorders.
Ioanna Papathanasiou et al.
Arthritis research & therapy, 14(2), R82-R82 (2012-04-20)
Events normally taking place in the terminal chondrocyte differentiation in the growth plate are also observed during osteoarthritis (OA) development, suggesting that molecules, such as Wnts and bone morphogenetic proteins (BMPs) regulating chondrocyte activity in the growth plate, may play
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Luqi Zhang et al.
Neurochemistry international, 87, 13-21 (2015-05-12)
Emerging studies have suggested the involvement of dysregulated Wnt/β-catenin cascade in the etiology of Alzheimer's disease (AD). Recently, genetic variations in Wnt co-receptor low density lipoprotein receptor-related protein (LRP) 6 causing reduced Wnt signaling has been linked to late-onset AD.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico