Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU147511

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAA

Ensembl | human accession no.

ENSG00000175104

NCBI accession no.

NM_004620

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF6(7189) , TRAF6(7189)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhiyong He et al.
Oncology reports, 35(4), 1933-1940 (2016-02-06)
Tumor necrosis factor receptor-associated factor 6 (TRAF6) has been found to be involved in multiple cancers. However, the effect of small interfering RNA (siRNA)‑induced knockdown of TRAF6 on the biological behaviors of cancer cells remains unknown. Thus, the present study
Quanfeng Wu et al.
Cancer cell international, 17, 62-62 (2017-06-09)
To study the mechanism by which epithelial ovarian cancer (EOC)-derived exosomes restore the migration of endothelial cells that is suppressed by TAM-derived exosomes. Exosomes were isolated from TAMs in the ascites of patients with EOC. The effect of exosomes on
Yancan Liang et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 47(6), 583-589 (2018-03-27)
Tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) has been proved to play an important role in tumorigenesis, invasion, and metastasis. However, its precise role salivary adenoid cystic carcinoma (SACC) has not been determined. The aim of this study was
Mengting Yang et al.
Stem cells international, 2020, 3296192-3296192 (2020-07-30)
Gastric cancer is the third most common type of tumor associated with death. TRAF6 belongs to the tumor necrosis factor receptor-associated factor family and has been demonstrated to be involved in tumor progression in various cancers. However, the exact effect
Eugenia M Yazlovitskaya et al.
Matrix biology : journal of the International Society for Matrix Biology, 77, 101-116 (2018-09-09)
Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins α3β1, α6β1 and α6β4 are usually co-expressed in cells and bind to
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico