Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU143641

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACACCTGGACCGAGTTTGTGGAGGGAAAGAATAAGACTGTGAGCAAGCTGGTGATCCAGAATGCCAACGTGTCTGCCATGTACAAGTGTGTGGTCTCCAACAAGGTGGGCCAGGATGAGCGGCTCATCTACTTCTATGTGACCACCATCCCCGACGGCTTCACCATCGAATCCAAGCCATCCGAGGAGCTACTAGAGGGCCAGCCGGTGCTCCTGAGCTGCCAAGCCGACAGCTACAAGTACGAGCATCTGCGCTGGTACCGCCTCAACCTGTCCACGCTGCACGATGCGCACGGGAACCCGCTTCTGCTCGACTGCAAGAACGTGCATCTGTTCGCCACCCCTCTGGCCGCCAGCCTGGAGGAGGTGGCACCTGGGGCGCGCCACGCCACGCTCAGCCTGAGTATCCCCCGCGTCGCGCCCGAGCACGAGGGCCACTATGTGTGCGAAGTGCAAGACCGGCGCAGCCATGACAAGCACTGCCACAAGAA

Ensembl | human accession no.

ENSG00000037280

NCBI accession no.

NM_002020

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FLT4(2324) , FLT4(2324)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
Joo-Hee Park et al.
PloS one, 9(9), e109055-e109055 (2014-10-01)
MAZ51 is an indolinone-based molecule originally synthesized as a selective inhibitor of vascular endothelial growth factor receptor (VEGFR)-3 tyrosine kinase. This study shows that exposure of two glioma cell lines, rat C6 and human U251MG, to MAZ51 caused dramatic shape
Raj Kumar et al.
Cell death & disease, 11(5), 325-325 (2020-05-10)
Pathological retinal neovascularization is the most common cause of vision loss. PKCθ has been shown to play a role in type 2 diabetes, which is linked to retinal neovascularization. Based on these clues, we have studied the role of PKCθ
Yan Zhang et al.
Nature communications, 9(1), 1296-1296 (2018-04-05)
Incomplete delivery to the target cells is an obstacle for successful gene therapy approaches. Here we show unexpected effects of incomplete targeting, by demonstrating how heterogeneous inhibition of a growth promoting signaling pathway promotes tissue hyperplasia. We studied the function

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico