EHU126001
MISSION® esiRNA
targeting human OTUD1
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
descripción
Powered by Eupheria Biotech
Nivel de calidad
Línea del producto
MISSION®
Formulario
lyophilized powder
secuencia objetivo ADNc esiRNA
ACTACATCGCCGACCATCTCGACCACTTCAGCCCCCTGATTGAGGGCGACGTGGGGGAGTTTATCATCGCTGCTGCCCAAGACGGGGCATGGGCCGGGTACCCGGAGTTGCTGGCCATGGGGCAGATGCTGAATGTGAATATCCATTTAACTACTGGAGGGAGGCTGGAGAGTCCCACGGTGTCTACCATGATTCATTATTTGGGCCCAGAG
Ensembl | nº de acceso humano
Nº de acceso NCBI
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Información sobre el gen
human ... OTUD1(220213) , OTUD1(220213)
Categorías relacionadas
Descripción general
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Shudong Piao et al.
Cellular signalling, 33, 22-29 (2017-02-22)
Ubiquitination and deubiquitination pathways play important roles in the regulation of p53 stability and activity. p53 is ubiquitinated and destabilized by E3 ubiquitin ligases and is deubiquitinated and stabilized by deubiquitinases (DUBs). We screened ovarian tumor (OTU) subfamily proteins to
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico