Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU108481

Sigma-Aldrich

MISSION® esiRNA

targeting human RBMX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACCACCACCAAGAAGTGGGGGTCCTCCTCCTAAGAGATCTGCACCTTCAGGACCAGTTCGCAGTAGCAGTGGAATGGGAGGAAGAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAGGTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACTAGAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nian Liu et al.
Nucleic acids research, 45(10), 6051-6063 (2017-03-24)
N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can
Katherine I Zhou et al.
Molecular cell, 76(1), 70-81 (2019-08-26)
N6-methyladenosine (m6A) modification occurs co-transcriptionally and impacts pre-mRNA processing; however, the mechanism of co-transcriptional m6A-dependent alternative splicing regulation is still poorly understood. Heterogeneous nuclear ribonucleoprotein G (hnRNPG) is an m6A reader protein that binds RNA through RRM and Arg-Gly-Gly (RGG)
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico