Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU094431

Sigma-Aldrich

MISSION® esiRNA

targeting human EDC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTGGCCTGTGGATGTTAGCCAGATCAAGCAGGGCTTCATTGTGGTAAAAGGTCATAGCACGTGCCTCAGTGAAGGAGCCCTCTCTCCTGATGGGACTGTGCTGGCTACTGCGAGCCACGATGGCTATGTCAAGTTCTGGCAGATCTACATTGAGGGGCAAGATGAGCCAAGGTGTCTGCACGAGTGGAAACCTCATGATGGGCGGCCCCTCTCCTGCCTCCTGTTCTGTGACAACCATAAGAAACAAGACCCTGATGTCCCTTTCTGGAGGTTCCTTATTACTGGTGCTGACCAGAACCGAGAGTTAAAGATGTGGTGTACAGTATCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTGCCCCCTAGCCTCAAGGTTTGCTTGGACCTCTCAGC

Ensembl | nº de acceso humano

ENSG00000038358

Nº de acceso NCBI

NM_014329

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EDC4(23644) , EDC4(23644)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

William R Brothers et al.
eLife, 9 (2020-06-09)
EDC4 is a core component of processing (P)-bodies that binds the DCP2 decapping enzyme and stimulates mRNA decay. EDC4 also interacts with mammalian MARF1, a recently identified endoribonuclease that promotes oogenesis and contains a number of RNA binding domains, including
Ameya P Jalihal et al.
Molecular cell, 79(6), 978-990 (2020-08-29)
Processing bodies (PBs) and stress granules (SGs) are prominent examples of subcellular, membraneless compartments that are observed under physiological and stress conditions, respectively. We observe that the trimeric PB protein DCP1A rapidly (within ∼10 s) phase-separates in mammalian cells during

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico