Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU092681

Sigma-Aldrich

MISSION® esiRNA

targeting human ADK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGTACAAGGGTATGGTAATGCTTGTAGAATCTTTATTATCTCAACAATCTAAAAAATGATGTTTATTTCCATAGTTTGATAGTGCCACTTAAATGCCAATTAAACAAGAATATAACATTTCAATAGAAATTTTTATTTCATTTTCAATTACTTTGTAAATTCGTGTGTATTTAGTACACTGATTTGTTTTTTTACATTTCTGCTTTGAATGCAGATGCAATTTAATATAATAGATTTTTTAATGAATTAATCTTAACATAGTAATCTTTAGCTTTTTATACAAATATATTTAATTTAGGAGTATATGTGTGTCTATACACACACATACATAAATATACCACATATACACCTGATAGTCAAATAAGGTACAGAAATTTTATCTTGTCAATTATGCCAAATAATCTCTTTAATGTGCACTCAAACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADK(132) , ADK(132)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Jin et al.
Journal of molecular histology, 47(3), 259-271 (2016-03-18)
Adenosine kinase (ADK) plays a pivotal role in regulating brain function by regulating adenosine level, and ADK inhibition protects against neuronal damage in cerebral ischemia and epilepsy; however, the effects of ADK in traumatic brain injury (TBI) have not been
Alexander J Valvezan et al.
JCI insight, 5(7) (2020-04-10)
Recent studies in distinct preclinical tumor models have established the nucleotide synthesis enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) as a viable target for antitumor therapy. IMPDH inhibitors have been used clinically for decades as safe and effective immunosuppressants. However, the potential to
Tal Israeli et al.
Journal of cell science, 131(15) (2018-07-14)
AMPK-mTORC1 signaling senses nutrient availability, thereby regulating autophagy. Surprisingly, we found that, in β-cells, the AMPK activator 5-amino-4-imidazolecarboxamide ribofuranoside (AICAR) inhibited, rather than stimulated, autophagy. AICAR is an intermediate in the generation of inosine monophosphate, with subsequent conversion to other
Wei Cao et al.
Life sciences, 256, 117972-117972 (2020-06-17)
Acute kidney injury (AKI) has a high morbidity and mortality, and there is no targeted treatment yet. One of the main causes of AKI is ischemia-reperfusion (IR). Increased release of adenosine under stress and hypoxia exerts anti-inflammatory and antioxidant effects.
Iwona Pelikant-Malecka et al.
The international journal of biochemistry & cell biology, 88, 31-43 (2017-03-23)
4-pirydone-3-carboxamide-1β-d-ribonucleoside (4PYR) is an endogenous nucleoside that could be converted to triphosphates, diphosphates, monophosphates and an analogue of NAD - 4PYRAD. Elevated level of these compounds have been reported in chronic renal failure, cancer and active HIV infection. However, little

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico