Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076011

Sigma-Aldrich

MISSION® esiRNA

targeting human FCGRT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTCCTGCTCTTTCTCCTTCCTGGGAGCCTGGGCGCAGAAAGCCACCTCTCCCTCCTGTACCACCTTACCGCGGTGTCCTCGCCTGCCCCGGGGACTCCTGCCTTCTGGGTGTCCGGCTGGCTGGGCCCGCAGCAGTACCTGAGCTACAATAGCCTGCGGGGCGAGGCGGAGCCCTGTGGAGCTTGGGTCTGGGAAAACCAGGTGTCCTGGTATTGGGAGAAAGAGACCACAGATCTGAGGATCAAGGAGAAGCTCTTTCTGGAAGCTTTCAAAGCTTTGGGGGGAAAAGGTCCCTACACTCTGCAGGGCCTGCTGGGCTGTGAACTGGGCCCTGACAACACCTCGGTGCCCACCGCCAAGTTCGCCCTGAACGGCGAGGAGTTCATGAATTTCGACCTCAAGCAG

Ensembl | human accession no.

ENSG00000104870

NCBI accession no.

NM_004107

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FCGRT(2217) , FCGRT(2217)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Huiqin Liu et al.
Journal of controlled release : official journal of the Controlled Release Society, 296, 40-53 (2019-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is a dominantly (~95%) KRAS-mutant cancer that has extremely poor prognosis, in part this is due to its strong intrinsic resistance towards almost all therapeutic agents. PDAC relies heavily on KRAS-transformed metabolism, including enhanced macropinocytosis and
Rafal Swiercz et al.
Oncotarget, 8(2), 3528-3541 (2016-12-16)
Tumor cells rely on high concentrations of amino acids to support their growth and proliferation. Although increased macropinocytic uptake and lysosomal degradation of the most abundant serum protein, albumin, in Ras-transformed cells can meet these demands, it is not understood
Giovanni S Offeddu et al.
Biomaterials, 212, 115-125 (2019-05-22)
Recent therapeutic success of large-molecule biologics has led to intense interest in assays to measure with precision their transport across the vascular endothelium and into the target tissue. Most current in vitro endothelial models show unrealistically large permeability coefficients due

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico