Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU066851

Sigma-Aldrich

MISSION® esiRNA

targeting human PYCARD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGAGGCTCCTTCCCAGCAACACTCCGGTCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lanny Gov et al.
mBio, 4(4) (2013-07-11)
Interleukin-1β (IL-1β) functions as a key regulator of inflammation and innate immunity. The protozoan parasite Toxoplasma gondii actively infects human blood monocytes and induces the production of IL-1β; however, the host and parasite factors that mediate IL-1β production during T.
Mairaj Ahmed Ansari et al.
PLoS pathogens, 11(7), e1005019-e1005019 (2015-07-03)
The IL-1β and type I interferon-β (IFN-β) molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16) involved in transcriptional regulation has
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Fushan Shi et al.
Journal of neuroinflammation, 9, 73-73 (2012-04-26)
Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico