Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU053421

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoqing Guo et al.
Anti-cancer drugs, 28(1), 66-74 (2016-09-08)
Tumor necrosis factor related apoptosis-inducing ligand (TRAIL) is a cytokine that selectively induces apoptosis in many tumor cells while leaving normal cells intact and is thus an attractive candidate for antitumor therapies. This paper reports that the combination of tunicamycin
Xiao-Ting Huang et al.
Life sciences, 232, 116612-116612 (2019-07-02)
Accumulating evidence suggest that endoplasmic reticulum (ER) stress is an important mechanism underlying the development of diabetes. We have reported that sustained treatment with N-methyl-d-aspartate (NMDA) results in apoptotic β-cell death and impairs insulin secretion. However, the molecular mechanism responsible
Ahmed A Gafar et al.
PeerJ, 4, e2445-e2445 (2016-11-30)
Lithocholic acid (LCA) is a secondary bile acid that is selectively toxic to human neuroblastoma, breast and prostate cancer cells, whilst sparing normal cells. We previously reported that LCA inhibited cell viability and proliferation and induced apoptosis and necrosis of
Lu Fan et al.
Frontiers in pharmacology, 8, 424-424 (2017-07-15)
Hepatocellular carcinoma (HCC) is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE), a casbane diterpenoid derived from the roots of
Maulasri Bhatta et al.
Cell death & disease, 9(5), 467-467 (2018-04-28)
Persistent vascular injury and degeneration in diabetes are attributed in part to defective reparatory function of angiogenic cells. Our recent work implicates endoplasmic reticulum (ER) stress in high-glucose-induced bone marrow (BM) progenitor dysfunction. Herein, we investigated the in vivo role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico