Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU044981

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC7A5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGGCACCAAACTGGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATGGAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAGAAACCTGCCCCTGGCCATCATCATCTCCCTGCCCATCGTGACGCTGGTGTACGTGCTGACCAACCTGGCCTACTTCACCACCCTGTCCACCGAGCAGATGCTGTCGTCCGAGGCCGTGGCCGTGGACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCATCCCCGTCTTCGTGGGCCTGTCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAGGCTCTTCTTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCCACAGCTCCTCACCCCCGTGCCGTCCCTCGTGTTCACGTGTGTGATGACGCTGCTCT

Ensembl | nº de acceso humano

ENSG00000103257

Nº de acceso NCBI

NM_003486

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC7A5(8140) , SLC7A5(8140)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZAV
BCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ling Wei et al.
Cancer science, 107(3), 347-352 (2016-01-11)
3-(18)F-l-α-methyl-tyrosine ([18F]FAMT), a PET probe for tumor imaging, has advantages of high cancer-specificity and lower physiologic background. FAMT-PET has been proved useful in clinical studies for the prediction of prognosis, the assessment of therapy response and the differentiation of malignant
Yu Takahashi et al.
Pharmaceutical research, 35(12), 246-246 (2018-10-31)
The anti-epileptic drug pregabalin crosses the blood-brain barrier (BBB) in spite of its low lipophilicity. This study was performed to determine whether L-type amino acid transporters (LAT1/SLC7A5 and LAT2/SLC7A8) contribute to the uptake of pregabalin. Pregabalin uptake by LATs-transfected HEK293
Keisuke Enomoto et al.
Scientific reports, 9(1), 14616-14616 (2019-10-12)
A novel therapeutic approach is urgently needed for patients with anaplastic thyroid cancer (ATC) due to its fatal and rapid progress. We recently reported that ATC highly expressed MYC protein and blocking of MYC through its selective inhibitor, JQ1, decreased
Danting Cao et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1195-1206 (2020-03-28)
MicroRNA-126-3p (miR-126) is required for angiogenesis during organismal development or the repair of injured arterial vasculature. The role of miR-126 in lung microvascular endothelial cells, which are essential for gas exchange and for lung injury repair and regeneration, remains poorly
Naoya Nakai et al.
Journal of cellular biochemistry, 119(2), 2094-2101 (2017-09-01)
Branched-chain amino acid supplements consumed following exercise are widely used to increase muscle mass. Although both exercise (ie, mechanical stimulation) and branched-chain amino acid leucine supplementation have been reported to stimulate muscle protein synthesis by activating the mammalian target of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico