Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030131

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAG

Ensembl | nº de acceso humano

ENSG00000134318

Nº de acceso NCBI

NM_004850

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ROCK2(9475) , ROCK2(9475)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
IYT
WNS
LLS
RZR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ye Wang et al.
PloS one, 11(1), e0146646-e0146646 (2016-01-09)
Some recent studies suggest that multiple miRNAs might regulate neurogenic transdifferentiation of mesenchymal stromal cells (MSCs). In the present study, we hypothesized that the miR-124 can repress the expression of RhoA upon the neurogenesis of adipose derived MSCs (ADMSCs). MiRNA
Cecilia Dyberg et al.
Cancers, 12(1) (2020-01-01)
Medulloblastoma is one of the most common malignant brain tumor types in children, with an overall survival of 70%. Mortality is associated with metastatic relapsed tumors. Rho-associated kinases (ROCKs), important for epithelial-mesenchymal transition (EMT) and proper nervous system development, have
Sarah Theresa Boyle et al.
Nature cell biology, 22(7), 882-895 (2020-05-27)
It is well accepted that cancers co-opt the microenvironment for their growth. However, the molecular mechanisms that underlie cancer-microenvironment interactions are still poorly defined. Here, we show that Rho-associated kinase (ROCK) in the mammary tumour epithelium selectively actuates protein-kinase-R-like endoplasmic
Ran You et al.
Clinical science (London, England : 1979), 134(12), 1357-1376 (2020-06-04)
Non-specific inhibition of Rho-associated kinases (ROCKs) alleviated renal fibrosis in the unilateral ureteral obstruction (UUO) model, while genetic deletion of ROCK1 did not affect renal pathology in mice. Thus, whether ROCK2 plays a role in renal tubulointerstitial fibrosis needs to
Ying-Ting Zhu et al.
The Journal of cell biology, 206(6), 799-811 (2014-09-10)
Currently there are limited treatment options for corneal blindness caused by dysfunctional corneal endothelial cells. The primary treatment involves transplantation of healthy donor human corneal endothelial cells, but a global shortage of donor corneas necessitates other options. Conventional tissue approaches
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico