Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023141

Sigma-Aldrich

MISSION® esiRNA

targeting human XPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCGAAGAATGTGGGAAAGAATTTATGGATTCTTATCTTATGAACCACTTTGATTTGCCAACTTGTGATAACTGCAGAGATGCTGATGATAAACACAAGCTTATAACCAAAACAGAGGCAAAACAAGAATATCTTCTGAAAGACTGTGATTTAGAAAAAAGAGAGCCACCTCTTAAATTTATTGTGAAGAAGAATCCACATCATTCACAATGGGGTGATATGAAACTCTACTTAAAGTTACAGATTGTGAAGAGGTCTCTTGAAGTTTGGGGTAGTCAAGAAGCATTAGAAGAAGCAAAGGAAGTCCGACAGGAAAACCGAGAAAAAATGAAACAGAAGAAATTTGATAAAAAAGTAAAAGAATTGCGGCGAGCAGTAAGAAGCAGCGTGTGGAAAAGGGAGACGATTGTTCATCAACATGAGTATGGACCAGAAGAAAACCTAGAAGATGACATGTACCGTAAGACTTGTACTATGTGTGGCCATGAACTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Yi Wen Kong et al.
Nature communications, 11(1), 4124-4124 (2020-08-19)
In response to DNA damage, a synthetic lethal relationship exists between the cell cycle checkpoint kinase MK2 and the tumor suppressor p53. Here, we describe the concept of augmented synthetic lethality (ASL): depletion of a third gene product enhances a
Mariangela Sabatella et al.
Cellular and molecular life sciences : CMLS, 77(10), 2005-2016 (2019-08-09)
The effectiveness of many DNA-damaging chemotherapeutic drugs depends on their ability to form monoadducts, intrastrand crosslinks and/or interstrand crosslinks (ICLs) that interfere with transcription and replication. The ERCC1-XPF endonuclease plays a critical role in removal of these lesions by incising

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico