Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU021051

Sigma-Aldrich

MISSION® esiRNA

targeting human MYC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

Ensembl | human accession no.

ENSG00000136997

NCBI accession no.

NM_002467

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYC(4609) , MYC(4609)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical
Yili Tao et al.
Scientific reports, 8(1), 14477-14477 (2018-09-29)
Colorectal cancer (CRC) is among the most frequently occurring cancers worldwide. Baicalin is isolated from the roots of Scutellaria baicalensis and is its dominant flavonoid. Anticancer activity of baicalin has been evaluated in different types of cancers, especially in CRC.
Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty
Xiao-Lu Ma et al.
Journal of hematology & oncology, 13(1), 11-11 (2020-02-07)
Aberrant AKT activation contributes to cancer stem cell (CSC) traits in hepatocellular carcinoma (HCC). We previously reported that CD73 activated AKT signaling via the Rap1/P110β cascade. Here, we further explored the roles of CD73 in regulating CSC characteristics of HCC.
Feifei Zhang et al.
EBioMedicine, 44, 311-321 (2019-05-13)
Gastric cancer (GC) ranks the fifth most common cancer, and chemotherapy is one of the most common treatments for GC. However, chemoresistance limits the effectiveness of chemotherapy and leads to treatment failure. This study aims to investigate the biological effect
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico