Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU020361

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGA

Ensembl | human accession no.

ENSG00000139842

NCBI accession no.

NM_001008895

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CUL4A(8451) , CUL4A(8451)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hiroshi Nakade et al.
International journal of clinical oncology, 25(3), 446-455 (2019-09-20)
Cullin4A (CUL4A), which is a component of E3 ubiquitin ligase, is implicated in many cellular events. Although the altered expression of CUL4A has been reported in several human cancers, the role of CUL4A in esophageal cancer remains unknown. We investigated
Yidan Ren et al.
Respiratory research, 20(1), 84-84 (2019-05-08)
Chronic obstructive pulmonary disease (COPD) is a common respiratory disease with high morbidity and mortality. The most important pathophysiological change of COPD is airway obstruction. Airway obstruction can cause airflow restriction and obstructive ventilation dysfunction. Currently, many studies have shown
B Englinger et al.
British journal of cancer, 116(4), 489-500 (2017-01-18)
Colorectal carcinoma (CRC) is the third most common cancer worldwide. Platinum-based anticancer compounds still constitute one mainstay of systemic CRC treatment despite limitations due to adverse effects and resistance development. Trabectedin has shown promising antitumor effects in CRC, however, again
Laura P Saucedo-Cuevas et al.
Oncotarget, 5(8), 2330-2343 (2014-05-30)
The CUL4A E3 ubiquitin ligase is involved in the regulation of many cellular processes and its amplification and/or overexpression has been observed in breast cancer. The 13q34 amplification, which is associated with the basal-like breast cancer subtype, has been proposed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico