Saltar al contenido
Merck

EHU013931

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sarah Ouahoud et al.
Oncogene, 39(12), 2453-2466 (2020-01-25)
Patients with the mesenchymal subtype colorectal cancer (CRC) have a poor prognosis, in particular patients with stroma-rich tumors and aberrant SMAD4 expression. We hypothesized that interactions between SMAD4-deficient CRC cells and cancer-associated fibroblasts provide a biological explanation. In transwell invasion
Long Yu et al.
Biochemical and biophysical research communications, 516(2), 546-550 (2019-06-27)
Circular RNAs (circRNAs) are emerging as important regulators in human disease. The expression profile and mechanism of circRNAs in postmenopausal osteoporosis remains largely unknown. Bone morphogenetic protein 2 (BMP2) is known to play important role in inducing osteogenic differentiation. MiR-98
Weijie Yang et al.
Journal of cellular biochemistry, 120(12), 19684-19690 (2019-08-23)
miR-129-5p is implicated in many diseases, such as laryngeal cancer and breast cancer. In this study, we studied the mechanism underlying the role of BMP2 in intervertebral disc degeneration (IDD). We used a luciferase assay system to determine the relationship
Zongyun Fu et al.
Archives of oral biology, 121, 104927-104927 (2020-11-03)
The aim of the present study was to investigate the role of fraxinellone in periodontitis and identify its potential mechanisms. Lipopolysaccharide-induced periodontal ligament stem cells (PDLSCs) was employed to simulate the periodontitis in vitro. The levels of inflammatory factors were
Wei Wang et al.
Molecular pain, 15, 1744806918824250-1744806918824250 (2019-02-26)
Bone cancer pain is one of the most severe and intractable complications in patients suffering from primary or metastatic bone cancer and profoundly compromises the quality of life. Emerging evidence indicates that the dorsal root ganglion play an integral role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico