Skip to Content
Merck
All Photos(1)

Key Documents

EMU060821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egr1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG

Ensembl | mouse accession no.

ENSMUSG00000038418

NCBI accession no.

NM_007913

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EGR1(13653) , Egr1(13653)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Yin-Hsun Feng et al.
BMC cancer, 19(1), 791-791 (2019-08-11)
Roles of cancer stem cells and early growth response gene 1 (Egr1) in carcinogenesis have been extensively studied in lung cancer. However, the role of Egr1 in the metastasis of lung cancer remains undetermined, especially in regard to stem cell-related
Sai Vikram Vemula et al.
Antiviral research, 139, 161-170 (2016-11-28)
The HIV latent CD4 Human CD4 Treatment of primary human CD4 Overall, our results offer new insights into the mechanism of action of PKC agonists, biomarkers of pathway engagement, and the potential role of EGR family in HIV reactivation.
Kazuhide Hayakawa et al.
Stem cell research, 12(2), 531-538 (2014-02-01)
Endothelial progenitor cells (EPCs) may contribute to neurovascular repair after stroke and neurodegeneration. A key step in this process should involve adhesive interactions between EPCs and the targeted cerebral endothelium. Here, we tested the hypothesis that reactive astrocytes may play
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service