Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU147451

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF31, RP11-468E2.4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTTGAAGGAGAAGCACATCACAGACATGGTGTGCCCTGCCTGTGGCCGCCCCGACCTCACCGATGACACACAGTTGCTCAGCTACTTCTCTACCCTTGACATCCAGCTTCGCGAGAGCCTAGAGCCAGATGCCTATGCGTTGTTCCATAAGAAGCTGACCGAGGGTGTGCTGATGCGGGACCCCAAGTTCTTGTGGTGTGCCCAGTGCTCCTTTGGCTTCATATATGAGCGTGAGCAGCTGGAGGCAACTTGTCCCCAGTGTCACCAGACCTTCTGTGTGCGCTGCAAGCGCCAGTGGGAGGAGCAGCACCGAGGTCGGAGCTGTGAGGACTTCCAGAACTGGAAACGCATGAACGACCCAGAATACCAGGCCCAGGGCCTAGCAATGTATCTTCAGGAAAACGGCATTGACTGCCCCAAATGCAAGTTCTCGTACGCC

Numéro d'accès Ensembl | humain

ENSG00000092098

Numéro d'accès NCBI

NM_017999

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RNF31(55072) , RNF31(55072)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique