Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU144011

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Aaron M Fleming et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(10), 2604-2609 (2017-02-02)
Reactive oxygen species (ROS) have emerged as important cellular-signaling agents for cellular survival. Herein, we demonstrate that ROS-mediated oxidation of DNA to yield 8-oxo-7,8-dihydroguanine (OG) in gene promoters is a signaling agent for gene activation. Enhanced gene expression occurs when
Nasrin Akhter et al.
The Journal of biological chemistry, 291(45), 23672-23680 (2016-09-18)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape1/Ref-1) is a multifunctional protein possessing DNA repair, redox control, and transcriptional regulatory activities. Although Ape1/Ref-1 plays multiple roles in the immune system, its functions in helper T (Th) cell activation and differentiation are largely unknown.
Shu-Ting Pan et al.
BMC cancer, 20(1), 634-634 (2020-07-10)
Drug resistance is a major cause of therapeutic failure that is often associated with elevated autophagy and apurinic/apyrimidinic endonuclease 1 (APE1) expression. Herein, we investigated the role of APE1 and autophagy in A549 cells treated with cisplatin. SILAC proteomics was
Mengxia Li et al.
Nucleic acids research, 46(11), 5664-5677 (2018-05-12)
Base excision repair (BER) handles many forms of endogenous DNA damage, and apurinic/apyrimidinic endonuclease 1 (APE1) is central to this process. Deletion of both alleles of APE1 (a.k.a. Apex1) in mice leads to embryonic lethality, and deficiency in cells can
Hong-Beum Kim et al.
Annals of surgical treatment and research, 92(1), 15-22 (2017-01-17)
Biliary cancer is a highly malignant neoplasm with poor prognosis and most patients need to undergo palliative chemotherapy, however major clinical problem associated with the use of chemotherapy is chemoresistance. So far, we aimed at investigating clinical implications of apurinic/apyrimidinic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique