Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU136431

Sigma-Aldrich

MISSION® esiRNA

targeting human NRGN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAGGCCAGAAGAACTGAGCATTTTCAAAGTTCCCGAGGAGAGATGGATGCCGCGTCCCCTTCGCAGCGACGAGACTTCCCTGCCGTGTTTGTGACCCCCTCCTGCCCAGCAACCTGCCAGCTACAGGAGCCCCCTGCGTCCCAGAGACTCCCTCACCCAGGCAGGCTCCGTCGCGGAGTCGCTGAGTCCGTGCCCTTTTAGTTAGTTCTGCAGTCTAGTATGGTCCCCATTTGCCCTTCCACTCCACCCCACCCTAAACCATGCGCTCCCAATCTTCCTTCTTTTGCTTCTCGC

Numéro d'accès Ensembl | humain

ENSG00000154146

Numéro d'accès NCBI

NM_001126181

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NRGN(4900) , NRGN(4900)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mariana Marin et al.
Viruses, 11(2) (2019-01-30)
The HIV-1 entry pathway into permissive cells has been a subject of debate. Accumulating evidence, including our previous single virus tracking results, suggests that HIV-1 can enter different cell types via endocytosis and CD4/coreceptor-dependent fusion with endosomes. However, recent studies
Mirko Theis et al.
Journal of biomolecular screening, 20(8), 1018-1026 (2015-04-26)
Broad sequencing enterprises such as the FANTOM or ENCODE projects have substantially extended our knowledge of the human transcriptome. They have revealed that a large portion of genomic DNA is actively transcribed and have identified a plethora of novel transcripts.
Isabel Weinheimer et al.
The Journal of general virology, 95(Pt 2), 486-495 (2013-11-05)
Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae) causes heavy yield losses in sweet potato plants co-infected with other viruses. The dsRNA-specific class 1 RNase III-like endoribonuclease (RNase3) encoded by SPCSV suppresses post-transcriptional gene silencing and eliminates antiviral
Deanna M Santer et al.
Journal of immunological methods, 445, 15-22 (2017-03-10)
Type III interferons (IFN-lambdas) are important antiviral cytokines that also modulate immune responses acting through a unique IFN-λR1/IL-10R2 heterodimeric receptor. Conflicting data has been reported for which cells express the IFN-λR1 subunit and directly respond to IFN-λs. In this study
Colin Watanabe et al.
RNA biology, 13(1), 25-33 (2016-01-21)
Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique