Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU113021

Sigma-Aldrich

MISSION® esiRNA

targeting human YAP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAGAGCCCTCAGGCAGACTGAATTCTAAATCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATT

Numéro d'accès Ensembl | humain

ENSG00000137693

Numéro d'accès NCBI

NM_006106

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... YAP1(10413) , YAP1(10413)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Akira Takaguri et al.
European journal of pharmacology, 815, 470-477 (2017-09-28)
Apoptosis of vascular smooth muscle cells (VSMCs) has been implicated in the progression of atherosclerosis, especially in vascular remodelling and plaque rupture. Although it is known that Yes-associated protein 1 (YAP1) is a critical molecule that regulates cell proliferation, differentiation
Marcel Trautmann et al.
EMBO molecular medicine, 11(5) (2019-03-23)
Myxoid liposarcomas (MLS), malignant tumors of adipocyte origin, are driven by the FUS-DDIT3 fusion gene encoding an aberrant transcription factor. The mechanisms whereby FUS-DDIT3 mediates sarcomagenesis are incompletely understood, and strategies to selectively target MLS cells remain elusive. Here we
Xiaojian Zhu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 207-207 (2020-10-08)
Accumulating evidence indicates that long non-coding RNAs (lncRNAs) acting as crucial regulators in tumorigenesis. However, its biological functions of lncRNAs in colorectal cancer (CRC) have not been systematically clarified. An unbiased screening was performed to identify disregulated lncRNAs revealed to
Takahiro Tsuji et al.
Nature communications, 11(1), 74-74 (2020-01-05)
Despite the promising clinical efficacy of the second-generation anaplastic lymphoma kinase (ALK) inhibitor alectinib in patients with ALK-rearranged lung cancer, some tumor cells survive and eventually relapse, which may be an obstacle to achieving a cure. Limited information is currently available
Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique