Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU109061

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCGTGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAATAATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGAACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGATAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCAGGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATAATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGAATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACGAGATACATAAAGACTTCTGGTAACGCCACTGTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feilong Wei et al.
Aging, 12(24), 26199-26220 (2020-12-22)
Ring finger protein 2 (RNF2) is an important component of polycomb repressive complex 1. RNF2 is upregulated in many kinds of tumors, and elevated RNF2 expression is associated with a poor prognosis in certain cancers. To assess the function of
Sen Zhu et al.
Nature communications, 9(1), 500-500 (2018-02-07)
BMI1, a polycomb group (PcG) protein, plays a critical role in epigenetic regulation of cell differentiation and proliferation, and cancer stem cell self-renewal. BMI1 is upregulated in multiple types of cancer, including prostate cancer. As a key component of polycomb
Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique