Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU062671

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX10, MIR6820

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGAAGGCAGGAAGGAGTTGGCACAGAGGCCCCCTGATCCAATTCTGTGCCAATAACCTCATTCTTTGTCTGAGAAACAGCCCCCAGTCCTCCTCCACTACAACCTCCATGACCTTGAGACGCATCCCAGGAGGTGACGAGGCAGGGGCTCCAGGAAAGGAATCAGAGACAATTCACAGAGCCTCCCTCCCTGGGCTCCTTGCCAGCTCCCTCTTCCCTTACTAGGCTCTATGGCCCCTGCTCAGTCAGCCCCACTCCCTGGGCTTCCCAGAGAGTGACAGCTGCTCAGGCCCTAACCCTTGGCTCCAGGAGACACAGGGCCCAGCACCCAGGTTGCTGTCGGCAGGCTGAAGACACTAGAATCCTGACCTGTACATTCTGCCCTTGCCTCTTACCCCTTGCCTCCCAGTGGTATTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Carmen Bravo González-Blas et al.
Nature methods, 16(5), 397-400 (2019-04-10)
We present cisTopic, a probabilistic framework used to simultaneously discover coaccessible enhancers and stable cell states from sparse single-cell epigenomics data ( http://github.com/aertslab/cistopic ). Using a compendium of single-cell ATAC-seq datasets from differentiating hematopoietic cells, brain and transcription factor perturbations
Wen Feng et al.
Biochemical and biophysical research communications, 485(2), 522-528 (2017-02-13)
The mechanisms modulating the cancer stem cell (CSC) properties of triple negative breast cancer (TNBC) cells were not fully understood. In this study, we performed data mining in Breast Cancer Gene-Expression Miner v4.0 and found that TNBC tumors had significantly
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique