Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU050131

Sigma-Aldrich

MISSION® esiRNA

targeting human RAF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGAGTGCTGTGCAGTGTTCAGACTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCTTTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAACTTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTCAATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTACCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACTATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCTGTTTCCAGGATGCCTGTT

Numéro d'accès Ensembl | humain

ENSG00000132155

Numéro d'accès NCBI

NM_002880

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RAF1(5894) , RAF1(5894)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jing Lin et al.
Cell cycle (Georgetown, Tex.), 19(19), 2496-2508 (2020-09-16)
Since the essential involvement of microRNAs (miRNAs) in the development and progression of GC, the study was for the exploration of the value of microRNA-7 (miR-7) in the evaluation of neoadjuvant chemotherapy for gastric cancer (GC) and its effects on
Xiaoyu Zhang et al.
ACS central science, 4(1), 71-80 (2018-02-03)
The KRAS gene encodes two isoforms, KRas4a and KRas4b. Differences in the signaling functions of the two KRas proteins are poorly understood. Here we report the comparative and nucleotide-dependent interactomes of KRas4a and KRas4b. Many previously unknown interacting proteins were
Ines Jeric et al.
Nature communications, 7, 13781-13781 (2016-12-22)
Hepatocellular carcinoma (HCC) is a leading cause of cancer deaths, but its molecular heterogeneity hampers the design of targeted therapies. Currently, the only therapeutic option for advanced HCC is Sorafenib, an inhibitor whose targets include RAF. Unexpectedly, RAF1 expression is
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique