Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU027651

Sigma-Aldrich

MISSION® esiRNA

targeting human SQSTM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGCAATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Akihito Arai et al.
American journal of cancer research, 7(4), 881-891 (2017-05-05)
Hypopharyngeal carcinoma is one of the worst prognostic malignancies among head and neck carcinomas. Therefore, a good biomarker should be identified to predict the best therapeutic option before starting the treatment. In cell models, p62/SQSTM1 levels affected the Nrf2-Keap1 pathway
Prasun Guha et al.
Oncotarget, 8(40), 68191-68207 (2017-10-06)
Studies suggest that tunicamycin may work as a therapeutic drug to cancer cells by inducing stress in the endoplasmic reticulum (ER) through unfolded protein response (UPR) and thereby promoting apoptosis. However, mechanisms of the prolonged activation of the UPR under
Alessia Garufi et al.
Biomolecules, 11(3) (2021-03-07)
The hyperactivation of nuclear factor erythroid 2 p45-related factor 2 (NRF2), frequently found in many tumor types, can be responsible for cancer resistance to therapies and poor patient prognosis. Curcumin has been shown to activate NRF2 that has cytotprotective or
Haofeng Ning et al.
Experimental and therapeutic medicine, 14(6), 5417-5423 (2017-12-30)
Macrophage autophagy has a protective role in the development of atherosclerosis; however, it turns dysfunctional in advanced lesions with an increase in p62/sequestosome-1 protein. Little is known about the role and significance of p62 accumulation in atherosclerosis. The present study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique