Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU000311

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGTGGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATTGACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCACCT

Numéro d'accès Ensembl | humain

ENSG00000125347

Numéro d'accès NCBI

NM_002198

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IRF1(3659) , IRF1(3659)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yihe Yan et al.
Cancer immunology, immunotherapy : CII, 69(9), 1891-1903 (2020-05-08)
The objective response rate of immune checkpoint blockade (ICB) in hepatocellular carcinoma (HCC) with anti PD-L1/PD-1 therapy is low. Discovering the signaling pathways regulating PD-L1 might help to improve ICB response rates. Here, we investigate transcription factors IRF-1 and IRF-2
Z-D Liu et al.
European review for medical and pharmacological sciences, 24(23), 12334-12341 (2020-12-19)
Cerebral ischemia/reperfusion (CIR) frequently causes serious disabilities and correlates with certain neurological processes. Some studies have shown that microRNAs (miRNAs) exert a neuroprotective effect by modulating the inflammatory process in CIR. However, the biofunction and the mechanism of miR-130b in
Jianhua Liu et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(9), 1840-1849 (2017-06-01)
The inflammasome complex is a driver of organ damage in patients with systemic lupus erythematosus (SLE). Although type I interferons (IFNs) are well established as mediators of SLE pathogenesis, their role in inflammasome activation in SLE has not been assessed.
Eri Sugiyama et al.
Science immunology, 5(43) (2020-02-02)
The clinical efficacy of anti-PD-1 (programmed cell death-1) monoclonal antibody (mAb) against cancers with oncogenic driver gene mutations, which often harbor a low tumor mutation burden, is variable, suggesting different contributions of each driver mutation to immune responses. Here, we
Lulu Tan et al.
American journal of cancer research, 10(4), 1255-1270 (2020-05-06)
Recent studies have shown that IRF-1 plays a significant role in various tumour-induced chemoresistance, but its role and mechanism in gastric cancer-associated chemoresistance are not clear. Our study showed that IRF-1 expression could reverse gastric cancer-related chemoresistance. Dysregulated DNA repair
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique