Skip to Content
Merck
All Photos(1)

Key Documents

EMU012771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Serpine2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTCCTCGTTAATGCAGTGTATTTCAAGGGTTTGTGGAAGTCTCGGTTTCAACCAGAGAGCACAAAGAAACGGACATTCGTGGCAGGTGATGGGAAATCCTACCAAGTACCCATGTTGGCTCAGCTCTCTGTGTTCCGCTCAGGGTCTACCAGGACCCCGAATGGCTTATGGTACAACTTCATTGAGCTGCCCTACCATGGTGAGAGCATCAGCATGCTGATCGCCCTGCCAACAGAGAGCTCCACCCCACTGTCTGCCATCATCCCTCACATCACTACCAAGACCATTGATAGCTGGATGAACACCATGGTACCCAAGAGGATGCAGCTGGTCCTACCCAAGTTCACAGCTGTGGCACAAACAGATCTGAAGGAGCCACTGAAAGCCCTTGGCATTACTGAGATGTTTGAGCCATCAAAGGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Kun Wang et al.
Journal of cancer research and clinical oncology, 141(5), 805-812 (2014-11-02)
Altered expression of serine protease inhibitor peptidase inhibitor clade E member 2 (SERPINE2) associates with human cancer development and progression; thus, this study investigated SERPINE2 expression in gastric cancer tissues for association with clinicopathological and survival data from the patients
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service