Skip to Content
Merck
All Photos(1)

Key Documents

EHU153781

Sigma-Aldrich

MISSION® esiRNA

targeting human SDC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACGGCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACGGGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGCCTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAGAAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAGAAGCCCACCAAACAGGAGGAATTCTATGCCTGACGCGGGAGCCATGCGCCCCCTCCGCCCTGCCACTCACTAGGCCCCCACTTGCCTCTTCCTTGAAGAACTGCAGGCCCTGGCCTCCCCTGCCACCAGGCCACCTCCCCAGCATTCCAGCCCCTCTGGTCGCTCCTGCCCACGGAGTCGTGGGGTGTGCTGGGAGCTCCACTCTGCTTCTCTGACTTCTGCCTGGAGACTTAGGGCACCAGGGGTTTCTCGCATAGGACCTTTCCACCACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shiyu Hu et al.
Frontiers in microbiology, 11, 105-105 (2020-03-11)
Porcine hemagglutinating encephalomyelitis virus (PHEV) is a single-stranded RNA coronavirus that causes nervous dysfunction in the infected hosts and leads to widespread alterations in the host transcriptome by modulating specific microRNA (miRNA) levels. MiRNAs contribute to RNA virus pathogenesis by
Zhou Jing et al.
Cell biology international, 44(3), 894-904 (2019-12-24)
Disabled-2 (Dab2) and PAR-3 (partitioning defective 3) are reported to play critical roles in maintaining retinal microvascular endothelial cells biology by regulating VEGF-VEGFR-2 signaling. The role of Dab2 and PAR-3 in glomerular endothelial cell (GEnC) is unclear. In this study
Saritha Adepu et al.
American journal of physiology. Renal physiology, 309(2), F137-F145 (2015-05-15)
Syndecan-1 is a transmembrane heparan sulfate proteoglycan involved in regenerative growth and cellular adhesion. We hypothesized that the induction of tubular syndecan-1 is a repair response to incipient renal damage in apparently stable, uncomplicated renal transplant recipients. We quantified tubular
Ildiko Kasza et al.
PLoS genetics, 10(8), e1004514-e1004514 (2014-08-08)
Homeostatic temperature regulation is fundamental to mammalian physiology and is controlled by acute and chronic responses of local, endocrine and nervous regulators. Here, we report that loss of the heparan sulfate proteoglycan, syndecan-1, causes a profoundly depleted intradermal fat layer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service