Skip to Content
Merck
All Photos(1)

Documents

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Ensembl | human accession no.

ENSG00000087470

NCBI accession no.

NM_005690

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNM1L(10059) , DNM1L(10059)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
Nicole L Mancini et al.
Cellular and molecular gastroenterology and hepatology, 11(2), 551-571 (2020-09-30)
Adherent-invasive Escherichia coli are implicated in inflammatory bowel disease, and mitochondrial dysfunction has been observed in biopsy specimens from patients with inflammatory bowel disease. As a novel aspect of adherent-invasive E coli-epithelial interaction, we hypothesized that E coli (strain LF82)
Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Raja Gopal Reddy Mooli et al.
Journal of cell science, 133(18) (2020-08-28)
Emerging evidence indicates that proper mitochondrial dynamics are critical for adipocyte differentiation and functional thermogenic capacity. We found that the mitochondrial fission protein dynamin-related protein 1 (DRP1, also known as DNML1) is highly expressed in brown adipose tissue compared to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service