Skip to Content
Merck
All Photos(1)

Documents

EHU051991

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAAGCCAGGGGAATAGGTAGCCACATCTTGTTTGCAGATAAGAAAGGAAGCTAACGCAGTATCTGCAAAGCCAGGAGTCTGACTCAGTACTTTTCTCACTCATGCATACAAAGCAGCTAAAAATGACACAGCTTATTTACCATGCCCCTGACACTGCACTGAGCACTTTATGAGCTTGAACTCTGTTAATCCTCACGACCACCTCATGAGACTCTCCAGAAAGAGCAACAGTAATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGTCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTACCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wayne Huey-Herng Sheu et al.
Arteriosclerosis, thrombosis, and vascular biology, 41(1), e46-e62 (2020-11-13)
Diabetic retinopathy, one of retinal vasculopathy, is characterized by retinal inflammation, vascular leakage, blood-retinal barrier breakdown, and neovascularization. However, the molecular mechanisms that contribute to diabetic retinopathy progression remain unclear. Approach and Results: Tpl2 (tumor progression locus 2) is a
Stefanie Voigt et al.
Nature communications, 11(1), 685-685 (2020-02-06)
IκB kinase 2 (IKK2) is well known for its pivotal role as a mediator of the canonical NF-κB pathway, which has important functions in inflammation and immunity, but also in cancer. Here we identify a novel and critical function of
D C Kanellis et al.
Oncogene, 34(19), 2516-2526 (2014-07-08)
Tumor Progression Locus 2 (TPL2) is widely recognized as a cytoplasmic mitogen-activated protein 3 kinase with a prominent role in the regulation of inflammatory and oncogenic signal transduction. Herein we report that TPL2 may also operate in the nucleus as

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service