Skip to Content
Merck
All Photos(1)

Key Documents

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | human accession no.

ENSG00000170345

NCBI accession no.

NM_005252

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FOS(2353) , FOS(2353)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H Pan et al.
Current molecular medicine, 16(3), 266-275 (2016-02-27)
Endometriosis is a frequent gynecological disease associated with severe pain and infertility. Although its dependency on estrogen is well recognized, the molecular mechanism along the estrogenic pathway has not been fully understood. This study investigates the effect of 17β-estradiol (E2)
Xiang Yin et al.
Journal of atherosclerosis and thrombosis, 24(1), 55-67 (2016-05-31)
Atherosclerosis is a chronic inflammatory disease, which leads to thrombosis and acute coronary syndrome. Matrix metalloproteinase-9 (MMP-9) is involved in the stability of the extracellular matrix (ECM) and atherosclerosis plaque. Until now, it is established that lipopolysaccharide (LPS) and norepinephrine
Huynh T Hop et al.
Frontiers in cellular and infection microbiology, 8, 287-287 (2018-09-07)
The cellular oncogene c-Fos (c-Fos) is a component of activator protein 1 (AP1), a master transcriptional regulator of cells. The suppression of c-Fos signaling by siRNA treatment resulted in significant induction of TLR4, which subsequently activates p38 and ERK1/2 mitogen-activated
Ningbo Zheng et al.
International journal of medical microbiology : IJMM, 309(8), 151340-151340 (2019-09-09)
Chlamydia pneumoniae (C. pneumoniae) infection is associated with the initiation and progression of atherosclerosis. The migration of vascular smooth muscle cell (VSMC) from the media to the intima is a key event in the development of atherosclerosis. Interleukin-17C (IL-17C) could
Rui Bao et al.
American journal of translational research, 8(5), 2284-2292 (2016-06-28)
Forkhead/winged helix transcription factor p3 (Foxp3) increases in CD4(+)CD25(+)Treg cells during sepsis; however, related mechanisms are unclear. Our study aimed to explore the possible molecular mechanisms of high expression of Foxp3 in Treg cells during sepsis. Sepsis was induced by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service