Skip to Content
Merck
All Photos(1)

Key Documents

EHU065071

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG

Ensembl | human accession no.

ENSG00000150093

NCBI accession no.

NM_002211

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITGB1(3688) , ITGB1(3688)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Cherine Abou Faycal et al.
British journal of cancer, 118(12), 1596-1608 (2018-05-26)
While lung adenocarcinoma patients can somewhat benefit from anti-angiogenic therapies, patients with squamous cell lung carcinoma (SQLC) cannot. The reasons for this discrepancy remain largely unknown. Soluble VEGF receptor-1, namely sVEGFR1-i13, is a truncated splice variant of the cell membrane-spanning
Rayanah Barnawi et al.
International journal of cancer, 145(3), 830-841 (2019-02-06)
Breast cancer remains the second cause of tumor-related mortality in women worldwide mainly due to chemoresistance and metastasis. The chemoresistance and metastasis are attributed to a rare subpopulation with enriched stem-like characteristics, thus called Cancer Stem Cells (CSCs). We have
Asma Boudria et al.
Oncogene, 38(7), 1050-1066 (2018-09-09)
Vascular endothelial growth factor-A (VEGF-A) is highly subjected to alternative pre-mRNA splicing that generates several splice variants. The VEGFxxx and VEGFxxxb families encode splice variants of VEGF-A that differ only at the level of six amino acids in their C-terminal
Ning Wang et al.
Human cell, 33(3), 663-675 (2020-05-16)
This study aims to investigate how Maspin affects the EMT and angiogenesis of gastric cancer (GC) cells via ITGB1/FAK pathway. Immunohistochemistry was used to evaluate the expressions of Maspin, ITGB1, FAK, E-cadherin, Vimentin, D2-40, and CD34 in GC and adjacent
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service