Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

HSTUD0500

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-33b-5p

Sinonimo/i:

hsa-miR-33b

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
12352200
NACRES:
NA.51

Nome Commerciale

MISSION®

Stato

solid

Sequenza matura

GUGCAUUGCUGUUGCAUUGC

N° accesso Sanger maturo/minor

N° accesso Sanger microRNA

Temperatura di conservazione

−20°C

Descrizione generale

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Altre note

Based on miRBase V19

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Pittogrammi

Health hazard

Avvertenze

Warning

Indicazioni di pericolo

Consigli di prudenza

Classi di pericolo

STOT RE 2 Inhalation

Organi bersaglio

Respiratory Tract

Codice della classe di stoccaggio

11 - Combustible Solids

Classe di pericolosità dell'acqua (WGK)

WGK 3

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiuxing Wang et al.
Cancer research, 77(18), 4947-4960 (2017-07-22)
Metabolic dysregulation drives tumor initiation in a subset of glioblastomas harboring isocitrate dehydrogenase (IDH) mutations, but metabolic alterations in glioblastomas with wild-type IDH are poorly understood. MYC promotes metabolic reprogramming in cancer, but targeting MYC has proven notoriously challenging. Here

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.