Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

HLTUD2167

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Human

hsa-miR-6125

Sinonimo/i:

Tough Decoy, TuD

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41106609
NACRES:
NA.51

Livello qualitativo

Nome Commerciale

MISSION®

Concentrazione

≥1x106 VP/ml (via p24 assay)

tecniche

capture ELISA: 106 TU/mL using p24 (Volume 200 uL)

Sequenza matura

GCGGAAGGCGGAGCGGCGGA

N° accesso Sanger maturo/minor

N° accesso Sanger microRNA

Condizioni di spedizione

dry ice

Temperatura di conservazione

−70°C

Descrizione generale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Altre note

Based on miRBase V19 Mature ID

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.