Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU210421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Erbb2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTCTGTCCCCCGAACAACCAAGAGGTCACAGCTGAGGACGGAACACAGCGGTGTGAGAAATGCAGCAAGCCCTGTGCTGGAGTATGCTATGGTCTGGGCATGGAGCACCTCCGAGGGGCGAGGGCCATCACCAGTGACAATATCCAGGAGTTTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTTTGCCGGAGAGCTTTGATGGGAACCCCTCCTCCGGCGTTGCCCCACTGAAGCCAGAGCATCTCCAAGTGTTCGAAACCCTGGAGGAGATCACAGGTTACCTATACATTTCAGCATGGCCAGAGAGCTTCCAAGACCTCAGTGTCTTCCAGAACCTTCGGGTCATTCGGGGACGGATTCTCCATGATGGTGCTTACTCATTGACGTTGCAAGGCCTGGGGATTCACTCACTGGGGCTACGCTCACTGCGGGAGCTGGGCAGTGGATTGGCTCTCATTCACCGCAACACCCATCTCTGCTTTGTAAACACTGTACCTTGGGACCA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chiao-Yun Lin et al.
Journal of molecular medicine (Berlin, Germany), 92(9), 969-981 (2014-05-14)
Endometrial cancers have been recently molecularly characterized; amplifications of human epidermal growth factor receptor 2 (HER2) were seen in 25 % of the serous-like tumors, and mutations in the PI(3)K/AKT pathways were seen in 93 % of endometrioid tumors. These new findings
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yu-Chieh Tsai et al.
Molecular cancer therapeutics, 14(3), 810-820 (2015-01-16)
Blockade of EGFR has been proved useful in enhancing the effect of radiotherapy, but the advantages of new-generation EGFR tyrosine kinase inhibitors (TKI) in radiosensitization are not well known. We used two human bladder cancer cells with wild-type EGFR to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.