Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU086511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thpo

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CACAGCTGTCCCAAGCAGTACTTCTCAACTCCTCACACTAAACAAGTTCCCAAACAGGACTTCTGGATTGTTGGAGACGAACTTCAGTGTCACAGCCAGAACTGCTGGCCCTGGACTTCTGAGCAGGCTTCAGGGATTCAGAGTCAAGATTACTCCTGGTCAGCTAAATCAAACCTCCAGGTCCCCAGTCCAAATCTCTGGATACCTGAACAGGACACACGGACCTGTGAATGGAACTCATGGGCTCTTTGCTGGAACCTCACTTCAGACCCTGGAAGCCTCAGACATCTCGCCCGGAGCTTTCAACAAAGGCTCCCTGGCATTCAACCTCCAGGGTGGACTTCCTCCTTCTCCAAGCCTTGCTCCTGATGGACACACACCCTTCCCTCCTTCACCTGCCTTGCCCACCACCCATGGATCTCCACCCCAGCTCCACCCCCTGTTTCCTGACCCTTCCACCACCATGCCTAACTCTACCGCCCCTCATCCAGTCACAATGTACCCTCATCCCAGG

N° accesso Ensembl | topo

ENSMUSG00000022847

N° accesso NCBI

NP_033405

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... THPO(21832) , Thpo(21832)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lina M E Pettersson et al.
PloS one, 9(6), e100730-e100730 (2014-06-27)
Peripheral nerve injury results in dramatic upregulation in pituitary adenylate cyclase activating polypeptide (PACAP) expression in adult rat dorsal root ganglia and spinal motor neurons mirroring that described for the neurotrophin brain derived neurotrophic factor (BDNF). Thus, we posited that
Sae Hyun Park et al.
International journal of oncology, 44(3), 637-646 (2014-01-01)
Fascin1 (FSCN1) involved in cell motility and filopodia assembly plays important roles in biological processes such as cancer invasion and metastasis of multiple epithelial tumors. High-grade serous ovarian carcinoma (HGSOC) is aggressive and metastatic by acquiring an invasive phenotype and
Peng Zhang et al.
PloS one, 9(5), e97647-e97647 (2014-05-17)
Plasma kisspeptin levels dramatically increased during the first trimester of human pregnancy, which is similar to pregnancy specific glycoprotein-human chorionic gonadotropin. However, its particular role in the implantation and decidualization has not been fully unraveled. Here, the study was conducted
Linn-Karina M Selvik et al.
PloS one, 9(11), e112485-e112485 (2014-11-11)
Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome
Shihai Liu et al.
International journal of clinical and experimental pathology, 7(8), 4857-4866 (2014-09-10)
Glioblastoma tumor cells release microvesicles, which contain mRNA, miRNA and angiogenic proteins. These tumor-derived microvesicles transfer genetic information and proteins to normal cells. Previous reports demonstrated that the increased microvesicles in cerebrospinal fluid (CSF) of patients with glioblastoma up-regulate procoagulant
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.