Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU063061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse C3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACGCCACTATGTCCATCCTGGACATCTCCATGATGACTGGCTTTGCTCCAGACACAAAGGACCTGGAACTGCTGGCCTCTGGAGTAGATAGATACATCTCCAAGTACGAGATGAACAAAGCCTTCTCCAACAAGAACACCCTCATCATCTACCTAGAAAAGATTTCACACACCGAAGAAGACTGCCTGACCTTCAAAGTTCACCAGTACTTTAATGTGGGACTTATCCAGCCCGGGTCGGTCAAGGTCTACTCCTATTACAACCTCGAGGAATCATGCACCCGGTTCTATCATCCAGAGAAGGACGATGGGATGCTCAGCAAGCTGTGCCACAGTGAAATGTGCCGGTGTGCTGAAGAGAACTGCTTCATGCAACAGTCACAGGAGAAGATCAACCTGAATGTCCGG

N° accesso Ensembl | topo

ENSMUSG00000024164

N° accesso NCBI

NM_009778

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... C3(12266) , C3(12266)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Manuela Veglia et al.
American journal of reproductive immunology (New York, N.Y. : 1989), 74(6), 542-552 (2015-09-22)
A threefold higher prevalence of antinuclear antibodies (ANA) has been reported in patients with recurrent pregnancy loss (RPL). Nevertheless, the role of ANA in reproductive failure is still unclear. The aim of this study was to investigate the role of
Eva-Maria Nichols et al.
Kidney international, 88(6), 1314-1322 (2015-07-30)
Abnormal regulation of the complement alternative pathway is associated with C3 glomerulopathy. Complement factor H is the main plasma regulator of the alternative pathway and consists of 20 short consensus repeat (SCR) domains. Although recombinant full-length factor H represents a
Masanori A Murayama et al.
Nature communications, 6, 8483-8483 (2015-09-26)
The complement system is important for the host defence against infection as well as for the development of inflammatory diseases. Here we show that C1q/TNF-related protein 6 (CTRP6; gene symbol C1qtnf6) expression is elevated in mouse rheumatoid arthritis (RA) models.
Hiroyuki Inoshita et al.
PloS one, 8(11), e78736-e78736 (2013-11-14)
The link between glomerular IgA nephropathy (IgAN) and T helper 2 (Th2) response has been implicated, however, the mechanisms are poorly defined because of the lack of an appropriate model. Here we report a novel murine model characterized by lineage-restricted
Miriam D Neher et al.
Journal of neuroinflammation, 11, 95-95 (2014-06-03)
Complement activation at the C3 convertase level has been associated with acute neuroinflammation and secondary brain injury after severe head trauma. The present study was designed to test the hypothesis that Cr2-/- mice, which lack the receptors CR2/CD21 and CR1/CD35
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.