Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU054211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATTCGCGTGGATAAGGAGTTCTCTGGTGTGCCCTGGAACTCACACGACATCTTCCAGTACCAAGACAAAGCCTATTTCTGCCATGGCAAATTCTTCTGGCGTGTGAGTTTCCAAAATGAGGTGAACAAGGTGGACCATGAGGTGAACCAGGTGGACGACGTGGGCTACGTGACCTACGACCTCCTGCAGTGCCCTTGAACTAGGGCTCCTTCTTTGCTTCAACCGTGCAGTGCAAGTCTCTAGAGACCACCACCACCACCACCACACACAAACCCCATCCGAGGGAAAGGTGCTAGCTGGCCAGGTACAGACTGGTGATCTCTTCTAGAGACTGGGAAGGAGTGGAGGCAGGCAGGGCTCTCTCTGCCCACCGTCCTTTCTTGTTGGACTGTTTCTAATAAACACGGATCCCCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAG

N° accesso Ensembl | topo

ENSMUSG00000017737

N° accesso NCBI

NM_013599

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MMP9(17395) , Mmp9(17395)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
RJU
IBS
AOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shan Lu et al.
Journal of cellular physiology, 230(8), 1862-1870 (2014-12-30)
MicroRNA-520c (miR-520c) and microRNA-373 (miR-373) are originally characterized as both oncogenes and tumor suppressors in different types of human cancers. In this study, we found that translation of mRNA of MT1-MMP, an oncogene related to tumor metastasis, was well inhibited
Pauli Puolakkainen et al.
Medical oncology (Northwood, London, England), 31(3), 884-884 (2014-02-15)
Patients with chronic pancreatitis with local inflammation have high risk for pancreatic cancer. The aim of this study was to examine the role of the inflammatory cells in the invasion of pancreatic cancer cells, focusing on the involvement of a
Ming-Ju Hsieh et al.
British journal of pharmacology, 171(12), 3037-3050 (2014-03-20)
High mortality and morbidity rates for hepatocellular carcinoma in Taiwan primarily result from uncontrolled tumour metastasis. Glabridin, a prenylated isoflavonoid of licorice (Glycyrrhiza glabra) roots, is associated with a wide range of biological properties, such as regulation of energy metabolism, oestrogenic
Yang Yu et al.
Biochemical and biophysical research communications, 463(3), 285-291 (2015-05-25)
Preeclampsia is a devastating pregnancy-related syndrome characterized by the onset of hypertension, proteinuria and edema. Insufficient invasion of trophoblasts is well-known to be correlated with preeclampsia development. The present study was performed to investigate the functional role microRNA (miRNA)-204 in
Hongmei Yu et al.
Experimental cell research, 333(1), 127-135 (2015-02-24)
Mucus hypersecretion is the key manifestation in patients with chronic inflammatory airway diseases and mucin 5AC (MUC5AC) is a major component of airway mucus. Matrix metalloproteinases (MMP)-9, have been found to be involved in the pathogenesis of inflammatory airway diseases.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.