Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU049451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cltc

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Spedizione prevista il14 aprile 2025

Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Spedizione prevista il14 aprile 2025

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCAGAGCTGGTGTTTCTGTATGACAAGTACGAAGAGTATGACAATGCCATCATTACCATGATGAATCACCCCACCGATGCATGGAAGGAAGGGCAGTTCAAAGACATCATCACCAAGGTGGCTAATGTGGAACTGTACTACAAAGCAATCCAGTTCTACTTAGAATTCAAGCCTTTGTTGTTAAATGACTTGCTCATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTAAAACAGCTACCACTGGTGAAACCATATTTACGCTCAGTGCAGAACCACAACAACAAATCTGTGAATGAATCACTGAACAACCTCTTTATTACTGAAGAAGATTACCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAACATCTCACTTGCTCAGCGTTTG

N° accesso Ensembl | topo

ENSMUSG00000047126

N° accesso NCBI

NM_001003908

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CLTC(67300) , Cltc(67300)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
NSS
YHS
AOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Odette Allonby et al.
Cellular signalling, 26(12), 2645-2657 (2014-08-26)
Ligand-induced internalisation and subsequent downregulation of receptor tyrosine kinases (RTKs) serve to determine biological outputs of their signalling. Intrinsically kinase-deficient RTKs control a variety of biological responses, however, the mechanism of their downregulation is not well understood and its analysis
Cyril Basquin et al.
The EMBO journal, 34(16), 2147-2161 (2015-07-01)
Endocytosis controls many functions including nutrient uptake, cell division, migration and signal transduction. A clathrin- and caveolin-independent endocytosis pathway is used by important physiological cargos, including interleukin-2 receptors (IL-2R). However, this process lacks morphological and dynamic data. Our electron microscopy

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.