Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU046811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atox1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGTGCCGCGTCAGTCATGCCGAAGCACGAGTTCTCCGTGGACATGACCTGTGAGGGCTGTGCTGAAGCCGTCTCCAGAGTCCTCAACAAGCTGGGAGGAGTGGAGTTCAACATTGACCTGCCCAACAAGAAGGTCTGCATCGACTCTGAGCACAGCTCAGACACCCTGCTGGCAACCCTCAACAAAACAGGAAAGGCTGTTTCCTACCTTGGCCCCAAGTAGCCAGGACCTGGGCGAGTCCTTCCGGATATAAACTGAAGAGGCAGGCTGTTGATCTGGTCTCCCCGGCAGATCTGGAACACCAACTGCTCAGTCCAGTCCAGCCCAGCCATGGAGTTCCTGCCCAGACAGGCCTTCCCCGCTGGCTCCCTGCAAGCTTCCATGTAATAAAGTCAAGCTGAGTTT

N° accesso Ensembl | topo

ENSMUSG00000018585

N° accesso NCBI

NM_009720

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... ATOX1(11927) , Atox1(11927)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Huawei Cai et al.
Oncology reports, 30(1), 269-275 (2013-04-30)
Copper is required for cell proliferation and tumor angiogenesis. Cellular copper metabolism is regulated by a network of copper transporters and chaperones. Antioxidant-1 (ATOX1) is a cytosolic copper chaperone important for intracellular copper transport, which plays a role in the
Gin-Fu Chen et al.
Scientific reports, 5, 14780-14780 (2015-10-07)
Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and
Arundhati Jana et al.
PloS one, 15(1), e0227916-e0227916 (2020-01-22)
Colorectal cancer remains a deadly cancer due to metastatic disease. To understand the molecular mechanisms of metastasis in colon cancer, we investigated whether the copper chaperone antioxidant-1 (Atox1) protein plays a role in this process. Recent findings indicate that Atox1
Edward A Ratovitski
Current pharmaceutical biotechnology, 16(9), 832-850 (2015-06-20)
MicroRNAs, whose transcription is regulated by members of the tumor protein p53 family, modulate the expression of numerous metabolic enzymes, significantly altering tumor cell response to chemotherapeutic treatments. The role for ΔNp63α-regulated microRNAs in regulation of cell cycle arrest, apoptosis

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.