Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU038061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTTTACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGCTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTGAGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTACACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGCATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGACAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAAT

N° accesso Ensembl | topo

ENSMUSG00000038160

N° accesso NCBI

NM_053069

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... ATG5(11793) , Atg5(11793)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhiqiang Liu et al.
Oncotarget, 6(33), 34329-34341 (2015-10-13)
A major problem in patients with multiple myeloma is chemotherapy resistance, which develops in myeloma cells upon interaction with bone marrow stromal cells. However, few studies have determined the role of bone marrow adipocytes, a major component of stromal cells
Rongsong Li et al.
Antioxidants & redox signaling, 23(15), 1207-1219 (2015-06-30)
Temporal and spatial variations in shear stress are intimately linked with vascular metabolic effects. Autophagy is tightly regulated in intracellular bulk degradation/recycling system for maintaining cellular homeostasis. We postulated that disturbed flow modulates autophagy with an implication in mitochondrial superoxide
Mark Thomas et al.
Frontiers in cell and developmental biology, 8, 565915-565915 (2020-11-13)
Many clinical trials are beginning to assess the effectiveness of compounds known to regulate autophagy in patients receiving anti-cancer chemotherapy. However, autophagy inhibition, through exogenous inhibitors, or activation, through starvation, has revealed conflicting roles in cancer management and chemotherapeutic outcome.
Ming Chen et al.
Autophagy, 13(11), 1813-1827 (2017-11-22)
Bacterial translocation and lipopolysaccharide (LPS) leakage occur at a very early stage of liver fibrosis in animal models. We studied the role of LPS in hepatic stellate cell (HSC) activation and the underlying mechanisms in vitro and in vivo. Herein
Qun Wu et al.
PloS one, 10(4), e0124524-e0124524 (2015-04-17)
Human rhinovirus (HRV) is the most common cause of acute exacerbations of chronic lung diseases including asthma. Impaired anti-viral IFN-λ1 production and increased HRV replication in human asthmatic airway epithelial cells may be one of the underlying mechanisms leading to
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.